snOPY snoRNA Orthological Gene Database
Felis_catus SNORD35
sequence
TGCAGATGATGTCTCTTCCTCACGATGGTCTGCGGGTGCCACTGTGGGTAGAGCAGATG
ATGCCAATGGCCCAGCTGATGCCAGGAG
  Box motif
  Complementary to target RNA
length 87
organism Felis_catus
snoRNA name SNORD35
alias
chromosome ⁄ contig scaffold_9240
locus ⁄ host gene Mono:84:SNORD35
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved