snOPY snoRNA Orthological Gene Database
Felis_catus SNORD36
sequence
TTGCAATGAAGATATATTGTATTGAATGATCTGAGGATCTGTGATTGGATAATAAGAGC
TTATTAAAACTGATGCCAG
  Box motif
  Complementary to target RNA
length 78
organism Felis_catus
snoRNA name SNORD36
alias
chromosome ⁄ contig scaffold_113850
locus ⁄ host gene Mono:74:SNORD36
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved