snOPY snoRNA Orthological Gene Database
Felis_catus SNORA73
sequence
GCAACGTGGGTATCCCGGGAGGTCGCTCTCCCCGGGTGCCGTCCGGGTGGCCTAGGGAG
CATAGGGGCTCAGCCCCGTGATGTTAAAGATGAAGCCGGGTCTACAGTCTCCACTTGAAT
ATTCCTATGGCTTCTCAGAGCCCTGTGGACGATGACTGAGGGGACAAACCATGCAGGAAA
CATCT
  Box motif
  Complementary to target RNA
length 184
organism Felis_catus
snoRNA name SNORA73
alias
chromosome ⁄ contig GeneScaffold_1373
locus ⁄ host gene Mono:113:SNORA73
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved