snOPY snoRNA Orthological Gene Database
Felis_catus SNORD18
sequence
ACATGTTGATAAAATCATCATTATGTTCCGTGTTTCTGAAACTTATACAAAGAAAGAAA
AGCCCTTACGAT
  Box motif
  Complementary to target RNA
length 71
organism Felis_catus
snoRNA name SNORD18
alias
chromosome ⁄ contig GeneScaffold_1365
locus ⁄ host gene Mono:109:SNORD18
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved