snOPY snoRNA Orthological Gene Database
Felis_catus SNORA71
sequence
ACCTGCATTCGAAAGTGATCATGGTCTGTCCGTGTCCTGGTCATCGATAGTGCAGGGAG
AGGACTTGCAGAAAGCACTTCCCCGTGTTTGGAGGGTCCCCTCTGTCCCTTCCAAACCCT
GGAGCTTTCCCACA
  Box motif
  Complementary to target RNA
length 133
organism Felis_catus
snoRNA name SNORA71
alias
chromosome ⁄ contig GeneScaffold_1721
locus ⁄ host gene Poly:22:SNORA71
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved