snOPY snoRNA Orthological Gene Database
Felis_catus SNORA62
sequence
TCACCACCCTTGGATTTGAGGCCACTGGCTTGTTGATAAACTCACAAGCGTGGGTAGTG
TGCTCCATGAGGGGCAAGTCTTTCACTGACAACACTAGGGTCTCTGAACCAATGAGTGGA
ATTTGATAGTAATCCCTGTTATAAGT
  Box motif
  Complementary to target RNA
length 145
organism Felis_catus
snoRNA name SNORA62
alias
chromosome ⁄ contig GeneScaffold_1605
locus ⁄ host gene Mono:105:SNORA62
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved