snOPY snoRNA Orthological Gene Database
Felis_catus SNORD25
sequence
CTCTCTGTGATGAGAACCTTTTCACAGACCTGTACTGAGCTCCGTGAGGATAAGACACT
CTGAAGAGAC
  Box motif
  Complementary to target RNA
length 69
organism Felis_catus
snoRNA name SNORD25
alias
chromosome ⁄ contig GeneScaffold_3186
locus ⁄ host gene Poly:26:SNORD22
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved