snOPY snoRNA Orthological Gene Database
Felis_catus SNORA71
sequence
TCCCGTGTCTGAAAGTGACTGCAGGCTGCCTGTGCCTTGGTCATTGGTAGGGCAGGGAG
AGGAGTCACCGAGAGAAGTTCCCGTGTTTGAAGGGTCCAGCCATCCTTTCCAAACCCTGG
AGCTTTCCCACA
  Box motif
  Complementary to target RNA
length 131
organism Felis_catus
snoRNA name SNORA71
alias
chromosome ⁄ contig scaffold_5321
locus ⁄ host gene Mono:30:SNORA71
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved