snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA49
sequence
CTCCCTCAGCCTTACTCCAAGGGCTTTGTCCTGTGAAGTGCCTTGGCATTGCCTGAGGG
AACAGCAACAGCACACCTCCCTCCCCAGGAAGATTCTGTTCTCCTGTGGGGCCTGCAGCC
TGCGCTGACAGC
  Box motif
  Complementary to target RNA
length 131
organism Erinaceus_europaeus
snoRNA name SNORA49
alias
chromosome ⁄ contig GeneScaffold_7776
locus ⁄ host gene EP400
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved