snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA30
sequence
CTAGAAATTTCACAGGTCCTACCCAGCAGGCAGTGGGGCCAGGATTTGGCAGCCGTAAC
TGAGAGAAAAACCCTTGATTGTATTCTTGCCCTGGGGCAGTGTCAGTGGCCATGGTCACT
CAGTGGAATAGAC
  Box motif
  Complementary to target RNA
length 132
organism Erinaceus_europaeus
snoRNA name SNORA30
alias
chromosome ⁄ contig GeneScaffold_926
locus ⁄ host gene SRCAP
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved