snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA12
sequence
AGTGGTGGTAGTCCTCCTCCTGGCACATTTGTTAAGTTTTCAAATGGGCTTGACTCTAC
CACATACATTACTTAGGAGCTGGCAAAGGCTTGATGACAAAGAGACCTCTCATCTCTCTC
TTGCCTTCCCCTTGTCAGATATTGGCTCCTACAGAG
  Box motif
  Complementary to target RNA
length 155
organism Erinaceus_europaeus
snoRNA name SNORA12
alias
chromosome ⁄ contig GeneScaffold_1948
locus ⁄ host gene CWF19L1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved