snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA28
sequence
AAGCAACACTCTGTGACAGATGACTGAAACAGTCTGGCACAATTTGAGTTTGCTGTAGC
AAGTAGTCTAACCTATTCTGGTATTCTCTCTTCCATGAGGCATGCTGTTATATAGACTTA
AACATT
  Box motif
  Complementary to target RNA
length 125
organism Erinaceus_europaeus
snoRNA name SNORA28
alias
chromosome ⁄ contig GeneScaffold_480
locus ⁄ host gene TMEM48
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved