snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA70
sequence
CGGCATCTGACTAAGCCCACCATGCTTCCTTTCCTGTGGGGCCTGGAGTGCAGTGGCTG
CAAGCAACAGCCTCCTGAGTTTGCATCCTGTTTCTTGTGCAGTTTGTTCCAAGGCACCTT
GAAGACAGCC
  Box motif
  Complementary to target RNA
length 129
organism Erinaceus_europaeus
snoRNA name SNORA70
alias
chromosome ⁄ contig GeneScaffold_6330
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved