snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORD78
sequence
TTGGAATGATGTTGATCAAATGTCTGACCTAAAATAAATATGTAGACAAGTTAACACTG
AAGGA
  Box motif
  Complementary to target RNA
length 64
organism Erinaceus_europaeus
snoRNA name SNORD78
alias
chromosome ⁄ contig scaffold_238927
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved