snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA3
sequence
GGCGAGGCTAGACTCTCACCCGGGCATGGCGTTGCCCTAGCATGCTGGAGTCCTCGGAG
GGCAGCTGCTGGCCTCATTCGCTGGCTGTGGCCCCATGGCCGAGCCAGTCACCAGGCCAG
AGACAAGT
  Box motif
  Complementary to target RNA
length 127
organism Erinaceus_europaeus
snoRNA name SNORA3
alias
chromosome ⁄ contig scaffold_249818
locus ⁄ host gene Mono:67:SNORA3
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved