snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORD25
sequence
TCTCTCAGTGATGAGGATCTTATCACAGACCTGTACCGAGATCCATGAGGATAAGACAC
TCTGAGGAGAC
  Box motif
  Complementary to target RNA
length 70
organism Erinaceus_europaeus
snoRNA name SNORD25
alias
chromosome ⁄ contig scaffold_202587
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved