snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA41
sequence
TCCCACAACTACTGGTCTGCAACTCTTCTTGTAGCCATTGTGGCATTCGTCTGTGGAAA
ATAAACTGCTACACAATGTAAATGCCCCATTAGCAAAATAGAAAGTGGACATGTGTGAGA
CAAACAA
  Box motif
  Complementary to target RNA
length 126
organism Erinaceus_europaeus
snoRNA name SNORA41
alias
chromosome ⁄ contig GeneScaffold_436
locus ⁄ host gene Mono:422:SNORA41
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved