snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORD49
sequence
TGCTCTGATGAAATCACTCATAGGAAGTGCCATCAGATGCGACAAATGTATGCACATGT
ATGCAC
  Box motif
  Complementary to target RNA
length 65
organism Erinaceus_europaeus
snoRNA name SNORD49
alias
chromosome ⁄ contig scaffold_347561
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved