snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA44
sequence
AAGCTTTTTGGTGAGGATGGCACCAAACTGCCTGTAAGAATAACCTGGAGAGACTGACA
GCACAGGTCAGCATAATACCTGTAGCTGCCACTCAGCTTCCCTATATTC
  Box motif
  Complementary to target RNA
length 108
organism Erinaceus_europaeus
snoRNA name SNORA44
alias
chromosome ⁄ contig scaffold_285300
locus ⁄ host gene Mono:76:SNORA44
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved