snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA30
sequence
AAAAAACTCATTCTATCTCCTCCCCTAGATTGTGGGGATAGGATTTGTTAGCTGGTACT
GAAACAAAATCCTTGATTGCATTCTTGCCCTGGGTCTGAGCTAGTGGCGGCTGTCAACTT
GATGGAACACAC
  Box motif
  Complementary to target RNA
length 131
organism Erinaceus_europaeus
snoRNA name SNORA30
alias
chromosome ⁄ contig GeneScaffold_4974
locus ⁄ host gene Mono:411:SNORA30
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved