snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORD74
sequence
GGCCTCCGCCTCTGATGAAGTCATTGTTGGTAGGGACAGCTGAGACGCTGATGAACGCC
AACGGCTCTGATGGCGGAAC
  Box motif
  Complementary to target RNA
length 79
organism Erinaceus_europaeus
snoRNA name SNORD74
alias
chromosome ⁄ contig scaffold_206122
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved