snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA40
sequence
AGCACTTGTTTGTTCGCTTTTGTTACTGAGCAAAAGTGATTAGACAAGTGCAAAAAATA
AATCCTCTTTTGCAACCCAGAGCTCATTGTTCAGTATGAGTTTTGATACATATAAGAAGG
AACATG
  Box motif
  Complementary to target RNA
length 125
organism Erinaceus_europaeus
snoRNA name SNORA40
alias
chromosome ⁄ contig scaffold_340906
locus ⁄ host gene Poly:6:SNORA48
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved