snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA48
sequence
GGTCTCTGTCCTGGGTAGAGTGGCATCTACCTTGTGGTGTCCATCTCATATCATCCAGG
GACAAAACGATTCCTTATTCTCCCAGCTTGGCCTTAGGTCTGTGCCCATGCCTGGTTCAT
GCCTGGGATATATTG
  Box motif
  Complementary to target RNA
length 134
organism Erinaceus_europaeus
snoRNA name SNORA48
alias
chromosome ⁄ contig scaffold_226897
locus ⁄ host gene Mono:290:SNORA48
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved