snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORD100
sequence
TCTGTACATGATAACAACTAGCTCCCTCTACCGAACTGTCATGAGGTAAACGCCATGTG
TAAAAAAAAAAAAAAAA
  Box motif
  Complementary to target RNA
length 76
organism Erinaceus_europaeus
snoRNA name SNORD100
alias
chromosome ⁄ contig GeneScaffold_3601
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved