snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA15
sequence
GCATGGCTGAATACTGTGTTTTTTTATCAGTAGTTTACACAGCCAGACACCATGCAAAA
GTAAAGTCTTCTTTTAAAATAACTATGATGTTATGCTATGTTTTTTATAGCATATCATTA
TTAAAAGTGGATACAAAT
  Box motif
  Complementary to target RNA
length 137
organism Equus_caballus
snoRNA name SNORA15
alias
chromosome ⁄ contig 13
locus ⁄ host gene CCT6A
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved