snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD18
sequence
CAGCAGTGATGAAATTCCACTCCATTGGTCCGTGTTTCTGAACCGCGTGATTTTCCTGG
ATGTTCTGATGCT
  Box motif
  Complementary to target RNA
length 72
organism Equus_caballus
snoRNA name SNORD18
alias
chromosome ⁄ contig 1
locus ⁄ host gene RPL4
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved