snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA33
sequence
AAGCCAGCCAATGAATCTGCTTACCTGAATGTGTTTTGGCAGAAATTTAGAGCAAGCTG
GCAATAGTAAAGCCATGTTACGAGCCTTAACGACGTTGAAGTCGTTAAGGTCCCTGAAAG
TGGCCACAAGA
  Box motif
  Complementary to target RNA
length 130
organism Equus_caballus
snoRNA name SNORA33
alias
chromosome ⁄ contig 10
locus ⁄ host gene Q6X9Y5_HORSE
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved