snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD33
sequence
TCGGCCAGTGATGAGGACTTCTCCCACTCGTGTTCGAGTTTCCCAACCATGAGATGACT
CCACATGCACTACCATCTGAGGCCGC
  Box motif
  Complementary to target RNA
length 85
organism Equus_caballus
snoRNA name SNORD33
alias
chromosome ⁄ contig 10
locus ⁄ host gene ENSECAG00000015832
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved