snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA49
sequence
CTCCCTCAGCCTTACTCCAGGGACTTTTGCTGTAAAGTGCCCTGGCATTGCCTGAGGGC
ACATGAAAAAGCACATATCCCTCCCCAGTAAGACTCTGTGTTCTTGTGGGGCCTACAGAT
TGAGCTGACAGT
  Box motif
  Complementary to target RNA
length 131
organism Equus_caballus
snoRNA name SNORA49
alias
chromosome ⁄ contig 8
locus ⁄ host gene EP400
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved