snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA69
sequence
TAAGCAGGTTGCAATTACAGTGCTTCATTTTGTGGAAGTACTGACATTATCCTGCTGAA
AGAAAATCTTGTGTGGATCATTTTTGATTTTGCCTTTGTGAGGGTAAAATCATGACAGAT
TGACATGGACAATT
  Box motif
  Complementary to target RNA
length 133
organism Equus_caballus
snoRNA name SNORA69
alias
chromosome ⁄ contig X
locus ⁄ host gene RPL39
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved