snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA53
sequence
AACATGCTTCCTTAGATCCACCTTTGTGGGTGTTAGTCTTGAACTGTGTTCTACTTGTA
AACTTCTTGTTTCTTGTAGTTCCGGTCAGAGAAACATCCAGCAACTTTTTTGGTTGTATA
GTCAAAGGTGCTTGAGTCATTGGCATGTGAGATAAATATACCTGCATGTTAGTCTTATGT
TCTGATAGAAATGACATGCAGTTGTGCTGTCATTTTTTTTACTATCAGGACTCGACTGGT
GTGCGGACACT
  Box motif
  Complementary to target RNA
length 250
organism Equus_caballus
snoRNA name SNORA53
alias
chromosome ⁄ contig 28
locus ⁄ host gene SLC25A3
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved