snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA26
sequence
GTGCCCTTTTAAGGTTGACGCAGTGCCTTAAGAGGCTAACACAGAAGGGCAAAGTAAGT
CTCCATAAAACCCTGAGAGGAGATTGTCAGACTCCTCTTTGGATCCTGTCTGGAGTCACA
GCT
  Box motif
  Complementary to target RNA
length 122
organism Equus_caballus
snoRNA name SNORA26
alias
chromosome ⁄ contig 3
locus ⁄ host gene RASL11B
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved