snOPY snoRNA Orthological Gene Database
Equus_caballus snoMBII-202
sequence
CAGTCTCCGGAATCTCTGCACGGCCTTGATGAAAGTGCACTGAACCCTTGTCCGTCTGA
CGGCCGGGCGCGC
  Box motif
  Complementary to target RNA
length 72
organism Equus_caballus
snoRNA name snoMBII-202
alias
chromosome ⁄ contig 3
locus ⁄ host gene RPL13
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved