snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD113
sequence
TGGATCGATGATGACTACTGGTGGCGTATGGGTCATATGTGATGAATATGTGTCTGGAA
CTCTGAGGTCCAA
  Box motif
  Complementary to target RNA
length 72
organism Equus_caballus
snoRNA name SNORD113
alias
chromosome ⁄ contig 24
locus ⁄ host gene Poly:5:SNORD113
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved