snOPY snoRNA Orthological Gene Database
Equus_caballus snoR38
sequence
TTGAGCCAAGGATGATTTAAAGTTATCCCTGTCTGAAGGGACATCTTTTGTGAGGAGTT
CTGACTTGCTGAGGCTCAG
  Box motif
  Complementary to target RNA
length 78
organism Equus_caballus
snoRNA name snoR38
alias
chromosome ⁄ contig 11
locus ⁄ host gene Poly:13:snoR38
organization Poly
target RNA
modification type unknown
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved