snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA8
sequence
TGCACTGCATGGTATCTGCATTCAGCAGTGTATTCCTGCTGGGTGTTCAAAGGACAGTG
CGACATAAATTCAGTATCTGGCATCGTTGGTTTTCTTTGCTTCGTGCATGTTAAACCTGG
TATTTTTATTGATACAGTA
  Box motif
  Complementary to target RNA
length 138
organism Equus_caballus
snoRNA name SNORA8
alias
chromosome ⁄ contig 7
locus ⁄ host gene Poly:8:SNORA40
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved