snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA63
sequence
TGGCAGGTTAAGGTTGATTGTTACAGTATAGCTGTGCAGTGCTATATTGTCCTTGCCCC
TGCTGAAAGCAATTGTTTCCTACAATCTCTGTCTAGCTGAATTCTATAGCAAGACAGGGA
CGCTTGGTCTCAAACAT
  Box motif
  Complementary to target RNA
length 136
organism Equus_caballus
snoRNA name SNORA63
alias
chromosome ⁄ contig 19
locus ⁄ host gene Poly:16:SNORA63
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved