snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD42
sequence
GTAAATTTTATCTATAAGGAAGCAAAAACCTGAGACTCGTGATGTCTTCAAAGGAACAA
CTGATGTAC
  Box motif
  Complementary to target RNA
length 68
organism Equus_caballus
snoRNA name SNORD42
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:50:SNORD42
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved