snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD116
sequence
GGATCGATGATGACTCCCTCATATGCATTCCTTGGAAAATCTGAACAAAATGAGTGAGA
ACTCACTACCGTCGTTCTCATCGAAACTGAGGTCC
  Box motif
  Complementary to target RNA
length 94
organism Equus_caballus
snoRNA name SNORD116
alias
chromosome ⁄ contig Un0338
locus ⁄ host gene Poly:21:SNORD116
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved