snOPY snoRNA Orthological Gene Database
Equus_caballus SCARNA9
sequence
TCTCTGAGATCTGCTCTTACTGAAGTGGACCAGTGATGAAAATAGCCAAATCCGAGCAC
CAGATGAGCTTCAAGTCTACCTGATGAGTGATCTCTGAGTTCTGAGAAGCAAAAGCATAG
AGTACAATATTGGCTCATGTCTAGGGTAATGTGTGTGTGTGTGAGTGTGTGTGTATAAAG
ACGGCAGTGGATAACTGAGGACTTGTCAATAGATAAATGAGTTTGGGGAGGGTGATGTGT
GTGTATGAAATTCTGAGCAATGATGAAAAAAGGTTTTACTACTGGCCTTTATAACTATGA
AAGTTTCGACACAAGCTGAGCTCA
  Box motif
  Complementary to target RNA
length 323
organism Equus_caballus
snoRNA name SCARNA9
alias
chromosome ⁄ contig 21
locus ⁄ host gene mono: SCARNA9
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved