snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD17
sequence
GTGAAATGATGATTCAGTTTATCCATTCGCTGAGTGCGCTGCACTGATCTTCTTCCAAG
CCTCGGTTCCTGTTCTAGGAACTCGGGGTTACGTAGCCTCCAAACACCCGGCAGTCTGTG
GTGTTCTACTGTGGACAGCTTGTGTGTTGGTGGACTACTGGTAAGAATGGTTGGTGTCAG
CAGGGATGGGTCCCTTGGGGTCTCATCTCACCAAGATGAGTGGTGGAAATCTGATCAC
  Box motif
  Complementary to target RNA
length 237
organism Equus_caballus
snoRNA name SNORD17
alias
chromosome ⁄ contig 22
locus ⁄ host gene Mono:7:SNORD17
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved