snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA17
sequence
ACTGCCCCTAGAGGCGTTACAGATGTGGCTGCGGTGTCACATTTGTGTCATTGGGTGGC
AGAGAGAAGAGAGGCTTGTCTACGCTCAGTGTTCTGGCCTGTGGACGCCTGGATGATGAA
TAGTCTGACACT
  Box motif
  Complementary to target RNA
length 131
organism Equus_caballus
snoRNA name SNORA17
alias
chromosome ⁄ contig 25
locus ⁄ host gene Poly:3:SNORA17
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved