snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA12
sequence
AGTTGTGGTGGCTTTCTTTCTGGCGCATTTGTTAAGTTTTCAGATGGGCCTGACTCTGC
CACATGTATTATTTAGGAGCTGGCAAAGGCTTGATGACAGAGATATCTCTCTAGCCTTTC
CTGCATCAGCGATTGGCTCTCACATGT
  Box motif
  Complementary to target RNA
length 146
organism Equus_caballus
snoRNA name SNORA12
alias
chromosome ⁄ contig 11
locus ⁄ host gene Mono:51:SNORA12
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved