snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD26
sequence
CTACGGGGATGATTTCAAGCACTGAACTCTCTCTTTCTGATGGCTTAGTGGAGAAAACG
TAAAAACTCTGAGTAGC
  Box motif
  Complementary to target RNA
length 76
organism Equus_caballus
snoRNA name SNORD26
alias
chromosome ⁄ contig 12
locus ⁄ host gene Poly:20:SNORD22
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved