snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD48
sequence
GACAATGATGACTCCAGGTGACTCTGAGTGTGTCGTTGACGACATCACCGCAGCGCGCT
GACC
  Box motif
  Complementary to target RNA
length 63
organism Equus_caballus
snoRNA name SNORD48
alias
chromosome ⁄ contig 20
locus ⁄ host gene Poly:17:SNORD48
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved