snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD92
sequence
CGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCAACTCACTGAGAGTAAATGAAGACT
TACAATTCCTTGGCTGTGTCTGAGCACC
  Box motif
  Complementary to target RNA
length 87
organism Echinops_telfairi
snoRNA name SNORD92
alias
chromosome ⁄ contig GeneScaffold_6798
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved