snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA2
sequence
TTGGCCCTGAATCAAGGCTAACAGTTTGATGGAGCTGTTGGCTTCAAGCAGGAGCCTAA
AGAAATGTCTTCCTATGGTCTGTTGGCCATTTCAGAACTTGGAAATGTAATGGTCAATTC
ATTAGAAAGAAACATCT
  Box motif
  Complementary to target RNA
length 136
organism Echinops_telfairi
snoRNA name SNORA2
alias
chromosome ⁄ contig GeneScaffold_4355
locus ⁄ host gene DDX52
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved