snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA28
sequence
AAGCAACACTCTGTGGCAGATGATCAAAACCGTCTGTCACAATTTGCGCTTGCCACAGC
AAAAAAAGTCTAACCTATTCCGGTGTTCTCTCCTCAGTGAGACTAGCCGTTATATGGACT
TGAACAAT
  Box motif
  Complementary to target RNA
length 127
organism Echinops_telfairi
snoRNA name SNORA28
alias
chromosome ⁄ contig GeneScaffold_551
locus ⁄ host gene ENSETEG00000015215
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved