snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA21
sequence
CCCCTTTTAAAAGCACTCATTGGACCTTTTGCCAGTGACCCACTGAACCGTCAAAAGGG
GCAGATTAAAAAACACCAATTTTGGGTGAAGCGGCAAACATCTCATGTTGTTCAGCTTCA
GTCAATGATGTGACAAAA
  Box motif
  Complementary to target RNA
length 137
organism Echinops_telfairi
snoRNA name SNORA21
alias
chromosome ⁄ contig GeneScaffold_1596
locus ⁄ host gene CLUAP1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved