snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD73
sequence
AATAAGTGATGAAAACCTGTTTCGGTCCCAGCTGATGTCCTGTGATAATGCACATTTTC
TGATGTT
  Box motif
  Complementary to target RNA
length 66
organism Echinops_telfairi
snoRNA name SNORD73
alias
chromosome ⁄ contig GeneScaffold_4674
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved